Species composition of Lactobacilli in young women of reproductive age with squamous intraepithelial lesions of the cervix

Among gynecological diseases in women in early reproductive life stages, high-grade squamous intraepithelial lesion (HSIL) of the cervix is a serious condition that has a high probability of malignant transformation. According to the data in Cancer Registry of N.N. Alexandrov Republican Scientific and Practical Medical Center of Oncology and Radiology center, 1772 cases of HSIL were registered among female population of the Republic of Belarus, of them 751 (42.38%) cases were registered in the age group of 18–35 years, that emphasizes the medical and social importance of timely diagnosis and prevention of this disease in young women [1]. The existing routine diagnostic methods can detect cervical lesions, but often overlook the molecular biological characteristics of the local microenvironment. Therefore, the search for minimally invasive markers associated with the severity of cervical lesions remains relevant. For this reason, the search for minimally invasive markers associated with cervical lesion severity remains relevant.

In recent years, increasing attention has been paid to the cervicovaginal microbiota as a factor that modulates the course of human papillomavirus (HPV) infection [2–5]. It has been shown that changes in the Lactobacillus species diversity can create the microenvironment that promotes long-term persistence of high-risk human papillomavirus (hrHPV) and can cause damage to cervical epithelial cells. [6–11]. However, the data on the structure of the Lactobacillus community in women in early reproductive life stages different degrees of cervical lesions remain understudied. Due to the above, the objective of the study was to conduct comparative analysis of the prevalence and relative abundance of the major Lactobacillus species (L. crispatus, L. gasseri, L. jensenii, L. iners) in women with low-grade squamous intraepithelial lesions (LSIL) and high-grade squamous intraepithelial lesions (HSIL) of the cervix in the early reproductive life stages.

Materials and methods

The study design and characteristics of participants

We analyzed the results of examination of 1027 women aged 18–35 years, who sought care at the 1st City Clinical Hospital in Minsk (the clinical base of the Department of Obstetrics and Gynecology with the Course of Advanced Training and Retraining, Belarusian State Medical University) in the period from September, 2020 to December 2025. The women underwent extended colposcopy due testing positive for HPV. Colposcopic findings were assessed according to the International Federation for Cervical Pathology and Colposcopy Guidelines (IFCPC) (2011) and using the Swede score. In 358 women, abnormal colposcopic images indicated necessity to perform a targeted cervical biopsy with subsequent histological examination, that was performed at City Clinical Pathological Anatomy Bureau in Minsk.

Among 358 histologically verified cases, the patients with the following conditions were excluded from the study: invasive cervical cancer (n=5); absence of  histological confirmation of cervical lesion (n=94); previous HPV vaccination (n=3); pregnancy or breastfeeding (n=18); the use of hormonal (except for combined hormonal contraceptives), antitumor, antimicrobial, antiviral, antifungal, antiseptic drugs, douching or douching products containing live microorganisms in any form for 8 weeks or less before sample collection (n=26); sexual intercourse;  gynecological exam, transvaginal ultrasound examination or  extended colposcopy 3 days of less before sample collection (n=19); acute inflammatory diseases of the pelvic organs or sexually transmitted infections during the time of sample collection (n=2).

The final analysis included 191 women in the early reproductive life stages (18–35 years) who had squamous intraepithelial lesions caused by hrHPV.  In this case-control study materials were prospectively collected, and the patient groups were retrospectively formed taking into consideration the degree of cervical lesion.   Group 1 (the controls, n=111, 58.11%) included the patients with low-grade squamous intraepithelial lesions (LSIL) of the cervix, ICD-10 N87.0. Group 2 (the cases, n=80, 41. 89%) included the patients with high-grade squamous intraepithelial lesions (HSIL) of the cervix, ICD-10 N87.1, N87.2, D06.

The protocol of the study and written informed consent form were approved by Biomedical Ethics Committee of Belarusian State Medical University (protocol No. 8 of May 07, 2024). The patients have signed informed consent for publication of their data.

Inclusion criteria in the study

The patients who met the following criteria were included in the study: age  18–35 years, positive HIV test results, histological diagnosis of squamous intraepithelial lesions of the cervix, luteal phase of the menstrual cycle (due to the data on restored Lactobacillus dominance after the end of menstrual bleeding in the late follicular phase and in the luteal phase [12–14]), absence of therapeutic and diagnostic interventions on the cervix for 1 month or more, that  made it possible to reduce their impact on the cervicovaginal microbiota.

Exclusion criteria were the following: absence of histologically confirmed diagnosis of squamous intraepithelial lesion; previous HPV vaccination; acute inflammatory diseases of the pelvic organs or sexually transmitted infections during the time of sample collection; the use of hormonal (except for combined hormonal contraceptives), antitumor, antimicrobial, antiviral, antifungal, antiseptic drugs, douches or any form of products containing live microorganisms 8 weeks or less before sample collection; sexual intercourse, gynecological examination, transvaginal ultrasound examination or extended colposcopy 3 days or less before sample collection; pregnancy or breastfeeding.

Collection and processing of biological

The samples were obtained from the surface of the cervical transformation zone using sterile universal Junona urogenital probes (Medical company “Simurg” LLC, Republic of Belarus) and transport medium with mucolytic agent solubilizing cervical mucus. The procedure was performed in accordance with the current guidelines for collecting the samples for cervical screening test [15].

DNA extraction and identification of microorganisms

Magnetic extraction of DNA from the samples was performed using ALPREP reagent kit (Algimed Techno LLC, Republic of Belarus).

Identification of Lactobacillus species was carried out using real-time PCR, Detection of L. crispatus, L. gasseri, L. jensenii was carried out using specific oligonucleotide primers (Sintol CJC, Russia) according to the method of Kostiuk S.A. et al.  [16].  L. iners and human gene SCARNA5 (long non-coding RNA in Cajal body) were identified using specific oligonucleotide primers (Primex DLC, Republic of Belarus) based on gene sequence retrieved from the NCBI GenBank database, and using Primer3Plus software [17].

Primer sequences:

1. crispatus: forward LcrisF – AGCGAGCGGAACTAACAGATTTAC, reverse LcrisR –AGCTGATCATGCGATCTGCTT;
2. gasseri: forward LgassF –AGCGAGCTTGCCTAGATGAATTTG, reverse LgassR – TCTTTTAAACTCTAGACATGCGTC;
3. jensenii: forward LjensF – AAGTCGAGCGAGCTTGCCTATAGA, reverse LjensR – CTTCTTTCATGCGAAAGTAGC;
4. iners: forward InersF – GTCTGCCTTGAAGATCGG, reverse InersR – ACAGTTGATAGGCATCATC;

Cajal body specific (SCARNA5): forward SC-F – CCTCCCGTCACATTTAAGTCA, reverse SC-R – GCCGATCACTCTCAGAAACAC.

The specificity of the primers was confirmed using Basic Local Alignment Search Tool (BLAST) [18].

For a 25 µl reaction we used 2x ready-to-use premix for RT-PCR containing thermostable hot-start Taq DNA polymerase, cat. No. 0085.2 (Primex DLC, Republic of Belarus); 1x solution of intercalating dye Zubr Green I, cat. No. 0010.2 (Primex DLC, Republic of Belarus) (analogue of SYBR Green I) in dimethyl sulfoxide (DMSO); the PCR grade water, cat. No. 0056.2 (Primex DLC, Republic of Belarus); and 500 nM of oligonucleotide concentration for each primer pair. PCR thermal cycling parameters included the initial denaturation/polymerase activation at 95°C for 5 min, once, 50 cycles: at 95°C for 5 seс, ХоС for 10 sec, melting at 72°C for 20 sec; Х1 (L. crispatus) at 58°C (peak melting temperature 87.0–87.5°C); Х2 (L. gasseri)  at 60°C (peak melting temperature 87.5–88.0°C); Х3 (L. jensenii) at 54°C (peak melting temperature  86.5–87.0°C); Х4 (L. iners) at 60°C (peak melting temperature 82.5–83.5°C); X5 (SCARNA5) at 60°C (peak melting temperature 82.5–83.5°C). The specificity of reactions was confirmed by electrophoresis (the data are not represented). Detection at the end of each elongation step was performed with FAM/Sybr using Tianlong Gentier 96 E/R Real-Time PCR System (Xi'an TianLong Science and Technology Co., Ltd, China).

Statistical analysis

Statistical processing of the results was performed using IBM SPSS Statistics 27.0.1 (IBM, USA). Data distribution was tested using the Shapiro–Wilk test. Due to non-normal distribution of dataset, the quantitative data in independent groups were compared using the Mann–Whitney U test, and the qualitative date were compared using Fisher’s exact test. Descriptive statistics of the quantitative data was represented as the median (Me) and interquartile range [Q1; Q3]. The level of significance was set at 0.05.

Results and discussion

Analysis of patients found no statistically significant differences between the groups. The median age of patients was 27 [25; 32] years in group 1, and 29 [25; 33] years in group 2 (р=0.111). Detailed analysis of distribution of women by age is represented in Table 1.

The median body mass index (BMI) in women with LSIL was 20.3 [18.9; 21.6] kg/m², and 20.9 [19.2; 24.3] kg/m² in women with HSIL. The intergroup difference was statistically significant (р=0.028). At the same time, detailed analysis found no differences between the patients in the frequency of underweight (р=0.588) or overweight (р=0.169). In group 1, 21/111 (18.92%) women  were underweight  (BMI<18.5 kg/m²) and 18/80 (22.50%) in group 2; 3/111 (2.70%) and  6/80 (7.50%) women  were overweight (BMI≥25.0 kg/m²), respectively.

Analysis of oncologic anamnesis in women in the studied groups showed that the overall incidence of malignant neoplasms in patients’ close relatives was 24.3% in group 1, and 31.3% in group 1, p=0.325.

Analysis of the structure and prevalence of external genital pathology classified according to ICD-10 classification (Table 2) found that the prevalence of somatic diseases in patients with HSIL was 56.25%, and 45.05% in women with LSIL, p=0,144 (Table 2).

Table 2 shows that diseases of the respiratory system in women with  HSIL occurred 2.5 times higher compared to women in group 1, p=0.002.

Assessment of menstrual function in both patient groups found no statistically significant differences between the groups in the median age at menarche – 13 (12; 14) years, p=0.431, the length of the menstrual cycle –28 (28; 30) days, p=0.621, and the duration of menstrual bleeding – 5 (5; 6) days, p=0.920. Among gynecological diseases intergroup differences were found in the prevalence of primary dysmenorrhea – 36.25% in the HSIL group versus 17.12% in the LSIL group, (p=0.004) and uterine fibroids – 11.25% and 2.70%, respectively.

The median age of primigravid women with LSIL was 24 (22; 25) years, and 23 [21; 25] years in patients with HSIL, p=0.605. High parity (giving birth 3 or more times) was in 2 (1.80%) women and in 1 (1.25%) in the groups, respectively, p=1.000.

Statistically significant intergroup differences were found with regard to reproductive anamnesis of patients, the frequency of using non-barrier method of contraception, smoking, pregnancy outcomes, recurrent dysbiosis of the vaginal microbiota (4 or more episodes of bacterial vaginosis or candidal vaginitis within 1 year and a history of urogenital chlamydia infection (Table 3).

The obtained data on intergroup differences with regard to vaginal microbiota imbalance supported the need for a detailed analysis of Lactobacillus species composition in the studied patient groups. For this purpose, the quantitative indicators of all studied microorganisms were normalized to human genomic DNA (the SCARNA5 gene) in the sample, that ensured comparability of the obtained results. The data were presented in relative units.

The relative abundance of each Lactobacillus species (%) was calculated as the ratio between individual standardized quantitative indicator to the total content of four Lactobacillus species in the probe. The results of comparative analysis of Lactobacillus species composition in the studied patient groups are represented in Table 4.

The data in Table 4 indicate statistically significant intergroup differences in relative abundance of  L. crispatus and L. iners. Thus, analysis showed a decrease in the quantity and relative abundance of L. crispatus in vaginal microbiota of patients in group 2, and an increase in these indicators of  L. iners (p<0.001). No statistically significant differences were found in other Lactobacillus species (p>0.05).

The obtained data confirm that among the studied lactobacillus species, vaginal microbiota of women with HSIL in early reproductive life stage is characterized by a significant decrease in L. crispatus and the dominance of L. iners compared to the patient with LSIL (р<0.001).

According to modern concepts about the different biological roles of some species of Lactobacillus, L. crispatus (its dominance was statistically significant in our study in patients with LSIL), synthesizes the isomer of D-lactic acid and has an evident antimicrobial effect, as well as bacteriocins and biosurfactants, creating unfavorable conditions for the persistence of hrHPV [19]. In contrast, L. iners produces the L-isomer of lactic acid with significantly lower protective potential and is characterized by low production of hydrogen peroxide. Inerolysin is secreted by L. iners, and can damage cervical epithelial cells and facilitate penetration of pathogens [20, 21].

The obtained results are consistent with the data obtained by foreign researchers. Xu X. et al. Reported that the dominance of L. iners in the cervical biotope is associated with high detection rate of HSIL [22]. Gomez Cherey J.F. et al. found that replacement of L. crispatus with L. iners promotes the persistence of hrHPV and occurrence of high-grade cervical lesions [23]. Our study confirms these findings and demonstrates that, along with traditional anamnestic factors, a decrease in relative abundance of L. crispatus is associated with HSIL.

However, limitations of our study should be taken into account.

Limitations. Despite the homogeneous group of the study participants, that allowed to minimize the influence of age and hormonal differences, strict standardization of inclusion and exclusion criteria, sufficient number of observations and mandatory histological confirmation of the diagnosis, this is a single-center study, that determines the local nature of the sample. Moreover, the control group of healthy women was not included in the study due to the study design and ethical limitations that excluded the performance of cervical biopsy and histological examination of biopsy samples without clinical indications. Due to this, further prospective multicenter research is needed to confirm the obtained findings.

Conclusion

This study found that in vaginal microbiota of women in the early reproductive life stage with HPV-associated HSIL species restructuring of the Lactobacillus community was found. It was characterized by statistically significant dominance of L. iners (p<0.001) and reduced abundance of L. crispatus compared to the patients with LSIL.

The findings in our study confirm association between cervicovaginal dysbiosis and the severity of cervical lesions in the study sample. This justifies the need for further research on Lactobacillus species composition in the vaginal microbiota of young women with HPV-associated cervical pathology.